Gene name |
SPAC3A11.06 |
Gene ID |
38/F12 |
Gene synonyms/obsolete |
mvp1 |
Gene product |
phosphoinositide
binding; PX domain; involved in intracellular protein
transport |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
2627 |
ORF length (spliced) |
1955 |
Entry clone length |
2627 |
No. of intron |
9 |
Sequence status |
Finished |
Sequence results |
Mixture |
Comments |
Mixture of 2 clones,
one of which is frameshifted from 205. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3A11.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCGATAATGTATTTTT |
Rev primer name |
SPAC3A11.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGTTTCAAGCCGAGAAAAA |
Amino acid length |
664 |
Molecular weight |
76.8 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi; vacuole
membrane |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |