| Gene name |
SPAC31A2.07c |
| Gene ID |
38/G05 |
| Gene synonyms/obsolete |
|
| Gene product |
DEAD/DEAH box
helicasw; ATP-dependent; RNA helicase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2647 |
| ORF length (spliced) |
2547 |
| Entry clone length |
2647 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1429T:C /
2189A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC31A2.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGGATTCCAGACGTC |
| Rev primer name |
SPAC31A2.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGATGCTTTTTTGACGGC |
| Amino acid length |
848 |
| Molecular weight |
94.6 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
55 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHLKVEMKLEL/LQDIIKLPL |
| Localization (YFP) |
nucleolus>>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |