| Gene name |
SPAC8C9.14 |
| Gene ID |
38/H04 |
| Gene synonyms/obsolete |
prr1 |
| Gene product |
heat shock
transcription factor; involved in oxidative stress response
(implicated); essential; involved in expression of oxidative
stress genes (ctt1 and trr1) (required); involved in
expression of sexual development genes (required); response
regulator receiver domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2669 |
| ORF length (spliced) |
1620 |
| Entry clone length |
2669 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC8C9.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGTCTTCGAACGGATC |
| Rev primer name |
SPAC8C9.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGTGGATGCTGTAAGTCT |
| Amino acid length |
539 |
| Molecular weight |
60 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVKPFTKLTL |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |