| Gene name |
SPAC637.02c |
| Gene ID |
39/B05 |
| Gene synonyms/obsolete |
tpr1;
SPAC27D7.14c |
| Gene product |
tetratricopeptide
repeat protein TPR repeat protein; involved in regulation of
transcription elongation; RNA polymerase II associated Paf1
complex; involved in potassium transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3120 |
| ORF length (spliced) |
|
| Entry clone length |
3120 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
123T:C / 3053A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC637.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGGTTTTACCTTGGA |
| Rev primer name |
SPAC637.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTTCATCCTCTTCAGAG |
| Amino acid length |
1039 |
| Molecular weight |
119.1 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPRVVDSDLYI |
| Localization (YFP) |
SPB?; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |