| Gene name |
SPAPYUK71.03c |
| Gene ID |
39/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
putative C2 domain
family protein C2 domain; similar to Sp SPCC962.01 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3678 |
| ORF length (spliced) |
|
| Entry clone length |
3678 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
515T:C / 1224C:T /
2971C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPYUK71.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCGCAGGCTGAGCC |
| Rev primer name |
SPAPYUK71.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTTGCCTTCTCGTGATGA |
| Amino acid length |
1225 |
| Molecular weight |
135.7 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRFGFLSLFI/LNSFSENLNL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |