Gene name |
SPBC146.13c |
Gene ID |
39/C03 |
Gene synonyms/obsolete |
myo1 |
Gene product |
putative myosin I
protein myosin I; actin cortical patch component; involved in
F-actin assembly; involved in cytokinesis; involved in actin
cortical patch distribution; type I myosin; involved in cell
cycle dependent actin filament organization; src (SH3)
homology domain; IQ domains |
Entry clone |
Cloned |
ORF length (unspliced) |
3698 |
ORF length (spliced) |
3654 |
Entry clone length |
3698 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
408T:C / 1557G:A /
3253C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC146.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAGTAAATATGCATG |
Rev primer name |
SPBC146.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCAATCTTCTTCTTCATCA |
Amino acid length |
1217 |
Molecular weight |
135.7 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQQIFIELTL/LHQIKYLGL |
Localization (YFP) |
periphery; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |