| Gene name |
SPAC3A11.01 |
| Gene ID |
39/C09 |
| Gene synonyms/obsolete |
SPAC328.01c |
| Gene product |
hypothetical GTPase
activating protein; putative Importin-beta family member;
yeast msn5 importin-beta family; exportin 5 family; involved
in nuclear export |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3788 |
| ORF length (spliced) |
3705 |
| Entry clone length |
3788 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3A11.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGAAAAAGGTTTATC |
| Rev primer name |
SPAC3A11.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCAAAGAGATTGGCCAAC |
| Amino acid length |
1234 |
| Molecular weight |
140.4 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQSLWSLSL/LITRLISVLVL/LPNVVPNLLKL |
| Localization (YFP) |
nucleus>>cytosol; nuclear envelope |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |