Gene name |
SPAC26A3.09 |
Gene ID |
39/C11 |
Gene synonyms/obsolete |
rga2 |
Gene product |
putative GTPase
activating protein GTPase activator; pleckstrin homology
domain; RhoGAP domain |
Entry clone |
Cloned |
ORF length (unspliced) |
3828 |
ORF length (spliced) |
|
Entry clone length |
3828 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1440T:C /
3807G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC26A3.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAAGATGGATGTTGT |
Rev primer name |
SPAC26A3.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAAAAATTCGTTATCCTCC |
Amino acid length |
1275 |
Molecular weight |
143.5 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |