| Gene name |
SPCC1672.11c |
| Gene ID |
39/D07 |
| Gene synonyms/obsolete |
|
| Gene product |
membrane ATPase;
P-type ATPase; P5 type; unknown specificity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3948 |
| ORF length (spliced) |
|
| Entry clone length |
3948 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
649G:A / 814C:T /
2912A:G / 2919T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1672.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATCTCCGAAGATGAT |
| Rev primer name |
SPCC1672.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACTTGTTCATTTTGCAAG |
| Amino acid length |
1315 |
| Molecular weight |
148.7 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYQAICLLTL/LKSVSQLLI/LGDFQFLFI |
| Localization (YFP) |
ER |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |