Gene name |
SPAC2G11.12 |
Gene ID |
39/D09 |
Gene synonyms/obsolete |
rqh1; hus2;
rad12 |
Gene product |
ATP-dependent DNA
helicase Hus2 ATP-dependent RecQ type DNA helicase; DEAD/DEAH
box helicase; involved in meiotic recombination; involved in
DNA repair; checkpoint-dependent DNA damage response during S
phase; involved in the processing of stalled and collapsed
replication forks; required for the maintenance of genome
stability; human disease associated; mutants display reduced
viability; mutants display elevated levels of chromosome loss;
3' to 5' DNA helicase activity; repair of UV-induced DNA
damage in G2; acts upstream of Rad51p; complexes with
Top3p |
Entry clone |
Cloned |
ORF length (unspliced) |
3987 |
ORF length (spliced) |
|
Entry clone length |
3987 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
613T:C / 963C:T /
1338T:C / 2312G:A / 3930T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2G11.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGTAACGAAAACAAA |
Rev primer name |
SPAC2G11.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGATAATTTTGCTTAACC |
Amino acid length |
1328 |
Molecular weight |
149.6 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDHLRKLNI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica,
Confocal |