Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPAC2G11.12
Gene ID 39/D09
Gene synonyms/obsolete rqh1; hus2; rad12
Gene product ATP-dependent DNA helicase Hus2 ATP-dependent RecQ type DNA helicase; DEAD/DEAH box helicase; involved in meiotic recombination; involved in DNA repair; checkpoint-dependent DNA damage response during S phase; involved in the processing of stalled and collapsed replication forks; required for the maintenance of genome stability; human disease associated; mutants display reduced viability; mutants display elevated levels of chromosome loss; 3' to 5' DNA helicase activity; repair of UV-induced DNA damage in G2; acts upstream of Rad51p; complexes with Top3p
Entry clone Cloned
ORF length (unspliced) 3987
ORF length (spliced)
Entry clone length 3987
No. of intron 0
Sequence status Finished
Sequence results 613T:C / 963C:T / 1338T:C / 2312G:A / 3930T:C
Comments
Polymerase used for cloning Platinum Taq HiFi (Invitrogen)
Fwd primer name SPAC2G11.12.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGACAGTAACGAAAACAAA
Rev primer name SPAC2G11.12.Rv
Rev primer SEQ AGAAAGCTGGGTAACGATAATTTTGCTTAACC
Amino acid length 1328
Molecular weight 149.6
Isoelectric point (calc.) 7.1
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) LDHLRKLNI
Localization (YFP) no apparent signal
Comments for localization
Effect of LMB on protein localization not determined
Microscope used for observation Leica, Confocal

Image information
  No image data registered.

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.