| Gene name |
SPAC57A7.05 |
| Gene ID |
39/D11 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein
hypothetical protein; leucine-serine rich |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4014 |
| ORF length (spliced) |
|
| Entry clone length |
4014 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
601A:G / 1292T:C /
1542T:C / 2024A:G / 2516A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC57A7.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGACTTCAGGTGCGCC |
| Rev primer name |
SPAC57A7.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACTAAGTCATGAGGAGAT |
| Amino acid length |
1337 |
| Molecular weight |
150.8 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
674 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWKTLFQFLLL/LMQAVRGILQI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |