| Gene name |
SPCC1450.11c |
| Gene ID |
39/E01 |
| Gene synonyms/obsolete |
cek1 |
| Gene product |
Ser/Thr protein kinase
Cek1 serine/threonine protein kinase; overexpression
suppresses anaphase blocking mutation cut8 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4017 |
| ORF length (spliced) |
|
| Entry clone length |
4017 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
612T:C / 1950T:C /
2890G:A / 3868A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1450.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCATATAAAAAACGA |
| Rev primer name |
SPCC1450.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAGTGCCAAACATCTAAC |
| Amino acid length |
1338 |
| Molecular weight |
149.8 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLKTMGVLDL/LSFFDNLAL/LKKIFPKLTL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |