Gene name |
SPAC17C9.03 |
Gene ID |
39/E03 |
Gene synonyms/obsolete |
tif471 |
Gene product |
translation initiation
factor (eIF4G); interacts physically with 43S ribosomal
preinitiation complex; interacts physically with Tif45p; MIF43
domain |
Entry clone |
Cloned |
ORF length (unspliced) |
4212 |
ORF length (spliced) |
|
Entry clone length |
4212 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
187A:G / 2052A:G /
2081A:G / 2295T:C / 2702G:addition / 2769T:A / 2796T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17C9.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCAAAACCACCGTC |
Rev primer name |
SPAC17C9.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGAACTAGTTTTTGAGTTA |
Amino acid length |
1403 |
Molecular weight |
154 |
Isoelectric point (calc.) |
9.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSGLESLSL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |