| Gene name |
SPAC24C9.07c |
| Gene ID |
39/E08 |
| Gene synonyms/obsolete |
bgs2; meu21 |
| Gene product |
1,3-beta-glucan
synthase subunit; glycosyl transferase family 48; involved in
sporulation; involved in spore wall assembly; involved in the
synthesis of a spore cell wall beta (1,3) glucan component;
meiotic expression upregulated; sporulation specific; similar
to Sp SPCC1840.02c and SPBC19G7.05c and SPAC19B12.03 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5685 |
| ORF length (spliced) |
|
| Entry clone length |
5685 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1099A:G / 1336A:G /
2744T:C / 3224A:G / 4300T:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC24C9.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATGGCATGAACAAGA |
| Rev primer name |
SPAC24C9.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCATTGACAGTGGTCCAA |
| Amino acid length |
1894 |
| Molecular weight |
219.1 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
16 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGGAVATLLML/LLKRFLILIL/LRILILAFLPI/LAKTVLSMLCI/LCHLLLFLML/LLLIAFLAL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |