Gene name |
SPBC6B1.01c |
Gene ID |
39/E09 |
Gene synonyms/obsolete |
SPBC1826.01c;
SPBC25B2.12c |
Gene product |
probable
helicase |
Entry clone |
Cloned |
ORF length (unspliced) |
5862 |
ORF length (spliced) |
|
Entry clone length |
5862 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1244A:G / 1417C:T /
1761A:G / 4097T:C / 5335C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC6B1.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAACACGCCTCGACCG |
Rev primer name |
SPBC6B1.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAAGCATCCTTGGGTAAA |
Amino acid length |
1953 |
Molecular weight |
217.6 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
285 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLNDFVSQLNI/LTTHVGGLGL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |