| Gene name |
SPBC1D7.02 |
| Gene ID |
39/E12 |
| Gene synonyms/obsolete |
scr1;
SPBC1D7.02c |
| Gene product |
glucose mediated
repressor of Inv1 transcriptional regulator; zinc finger
protein; zf-C2H2 type; glucose mediated repressor of inv1 and
fbp1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1698 |
| ORF length (spliced) |
|
| Entry clone length |
1698 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1D7.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGAAGCCACCACTGC |
| Rev primer name |
SPBC1D7.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGGCTTGGTCATAGGAGTT |
| Amino acid length |
565 |
| Molecular weight |
59.7 |
| Isoelectric point (calc.) |
10.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPSIRSLSL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |