| Gene name |
SPAC17D4.02 |
| Gene ID |
39/F03 |
| Gene synonyms/obsolete |
sna41; goa1 |
| Gene product |
Cdc45 related protein
pre-replicative complex; involved in DNA replication
(initiation); involved in loading of DNA polymerase alpha onto
MRC complex (required); essential; chromatin binding during S
phase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1958 |
| ORF length (spliced) |
1917 |
| Entry clone length |
1958 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17D4.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCATCAAGAGATCCGA |
| Rev primer name |
SPAC17D4.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATAGTGTTTTGAAGGAC |
| Amino acid length |
638 |
| Molecular weight |
73.3 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
205/187/343 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKIFMHPLAL |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |