Gene name |
SPBC16H5.03c |
Gene ID |
39/F05 |
Gene synonyms/obsolete |
uba2 |
Gene product |
ubiquitin-activating
enzyme E1-like ubiquitin activating enzyme; e1-like |
Entry clone |
Cloned |
ORF length (unspliced) |
2059 |
ORF length (spliced) |
1887 |
Entry clone length |
2059 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC16H5.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAACCCTAATGCAACT |
Rev primer name |
SPBC16H5.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATAGTGTGTATTTTCGCT |
Amino acid length |
628 |
Molecular weight |
70.6 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRDSIRRLAL/LDKTFDDLGI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |