Gene name |
SPBC25H2.02 |
Gene ID |
39/F07 |
Gene synonyms/obsolete |
ths1 |
Gene product |
threonyl-tRNA
synthetase; cytoplasmic threonyl-tRNA synthetase; involved in
threonyl-tRNA aminoacylation; threonine-tRNA ligase
activity |
Entry clone |
Cloned |
ORF length (unspliced) |
2112 |
ORF length (spliced) |
|
Entry clone length |
2112 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
107A:G / 481A:G /
840A:G / 876T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC25H2.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGCAGCTGCTGTTAA |
Rev primer name |
SPBC25H2.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAGGTCGTTAATCAGACTT |
Amino acid length |
703 |
Molecular weight |
80.1 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
DeltaVision |