| Gene name |
SPBC15D4.03 |
| Gene ID |
39/F12 |
| Gene synonyms/obsolete |
slm9 |
| Gene product |
WD repeat protein;
involved in mitotic control WD repeat protein; involved in
mitotic control; pleiotrophic signal transducer for cell
growth; similar to Sp SPBC15D4.03 |
| Entry clone |
Cloned (also cloned in
2004 trial) |
| ORF length (unspliced) |
2424 |
| ORF length (spliced) |
|
| Entry clone length |
2424 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC15D4.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCACATTTTTGTGCCTAA |
| Rev primer name |
SPBC15D4.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAAGTGCAGATCGTCGT |
| Amino acid length |
807 |
| Molecular weight |
90.4 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQRLVKALML/LEYDFRENLIL/LCKELLGPLRI |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |