| Gene name |
SPBC23G7.15c |
| Gene ID |
39/G08 |
| Gene synonyms/obsolete |
rpp202; rpp2-2;
rpa4 |
| Gene product |
60S acidic ribosomal
protein p2-beta (P2B subunit); similar to Sp SPBP8B7.06 and
SPAC1071.08 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
379 |
| ORF length (spliced) |
333 |
| Entry clone length |
379 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC23G7.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATATTTAGCTGCATA |
| Rev primer name |
SPBC23G7.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAAAAAGACCGAATCCC |
| Amino acid length |
110 |
| Molecular weight |
11.1 |
| Isoelectric point (calc.) |
3.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |