Gene name |
SPBC1A4.01 |
Gene ID |
40/A07 |
Gene synonyms/obsolete |
apc10;
SPBC1E8.06 |
Gene product |
anaphase-promoting
complex (APC); regulators of the APC-cyclosome; involved in
cyclin degradation (required); involved in metaphase-anaphase
transition (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
699 |
ORF length (spliced) |
570 |
Entry clone length |
699 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
301A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1A4.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGCAAATTCGACAAGA |
Rev primer name |
SPBC1A4.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCGTAATTGGTTTCTACTT |
Amino acid length |
189 |
Molecular weight |
21.4 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |