Gene name |
SPBC20F10.06 |
Gene ID |
40/A08 |
Gene synonyms/obsolete |
mad2 |
Gene product |
spindle assembly
checkpoint component; horma domain |
Entry clone |
Cloned |
ORF length (unspliced) |
699 |
ORF length (spliced) |
612 |
Entry clone length |
699 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
42T:C / 477T:C /
604A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC20F10.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTAGCGTTCCCATAAG |
Rev primer name |
SPBC20F10.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGATTCACTCGATATGCA |
Amino acid length |
203 |
Molecular weight |
23.5 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
accumulated ER by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |