| Gene name |
SPBC1289.03c |
| Gene ID |
40/B10 |
| Gene synonyms/obsolete |
spi1 |
| Gene product |
small GTPase; Ras
family; GTP-binding protein; involved in mitosis (required);
involved in interphase transition (required); involved in
nuclear-cytoplasmic transport; involved in cell cycle
progression; involved in DNA replication; involved in
chromosome segregation; overexpression rescues pim1 mutant;
deletion mutant results in genome instability; interacts
physically with Pim1p; interacts physically with Mog1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
970 |
| ORF length (spliced) |
651 |
| Entry clone length |
970 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1289.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTCAACCACAAAACGT |
| Rev primer name |
SPBC1289.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAATCAGCGTCATCCTCA |
| Amino acid length |
216 |
| Molecular weight |
24.5 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
125 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery;
nucleus>cytosol |
| Comments for localization |
weak signal of
nucleus>cytosol |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |