| Gene name |
SPAC3C7.03c |
| Gene ID |
40/C10 |
| Gene synonyms/obsolete |
rhp55 |
| Gene product |
H-h-H
(helix-hairpin-helix) (inferred from context); putative
divergent AAA family ATPase; involved in DNA repair; involved
in meiotic recombination; involved in meiotic gene conversion
(required); deletion mutant sensitive to MMS; deletion mutant
sensitive to IR; deletion mutant sensitive to UV; deletion
mutant results in nuclear morphology defects (frequent);
deletion mutant results in elongated cells (frequent);
deletion mutant results in sporulation defects; deletion
mutant results in decreased spore viability; deletion mutant
results in decreased sporulation efficiency; deletion mutant
results in recombination defects; interacts physically with
Rhp57p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1097 |
| ORF length (spliced) |
1053 |
| Entry clone length |
1097 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3C7.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGTCTAGTCAACGTAT |
| Rev primer name |
SPAC3C7.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGACTCACATTCCAAAATG |
| Amino acid length |
350 |
| Molecular weight |
38.9 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKEIGLLII/LDNLSYRLIL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |