| Gene name |
SPBC32F12.06 |
| Gene ID |
40/C12 |
| Gene synonyms/obsolete |
pch1 |
| Gene product |
cyclin homolog;
complexed with Cdk9p; not reciprocal best hit; functional
homolog of Sc YLR226W |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
1129 |
| ORF length (spliced) |
1029 |
| Entry clone length |
1129 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC32F12.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAAGTAATAAAATC |
| Rev primer name |
SPBC32F12.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAAGCTTCCGTCTCCATC |
| Amino acid length |
342 |
| Molecular weight |
38.2 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |