Gene name |
SPBC337.08c |
Gene ID |
40/D01 |
Gene synonyms/obsolete |
ubi4 |
Gene product |
ubiquitin family
protein; involved in meiosis (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
1149 |
ORF length (spliced) |
|
Entry clone length |
1149 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
Maybe another
homolog |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC337.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGATTTTCGTCAAGAC |
Rev primer name |
SPBC337.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAAAGACCGCCACGAAGA |
Amino acid length |
382 |
Molecular weight |
42.9 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear envelope; SPB;
periphery; site of septum formation; nucleus>cytosol |
Comments for localization |
observed by N-terminal
tagging of GFP |
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |