| Gene name |
SPAC1A6.09c |
| Gene ID |
40/D03 |
| Gene synonyms/obsolete |
lag1 |
| Gene product |
longevity-assurance
protein 1; lipid sensing domain; involved in intracellular
protein transport; involved in ceramide synthesis; similar to
Sp SPBC3E7.15C; involved in ER to golgi transport; involved in
GPI-anchored protein transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1173 |
| ORF length (spliced) |
|
| Entry clone length |
1173 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1A6.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAACCGAAAAGCTGA |
| Rev primer name |
SPAC1A6.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTATCCTCATTCGTTGAA |
| Amino acid length |
390 |
| Molecular weight |
45.6 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCFWFLGLYI/LGFWLQQILVL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |