Gene name |
SPAC8E11.02c |
Gene ID |
40/D06 |
Gene synonyms/obsolete |
rad24 |
Gene product |
involved in DNA
repair; involved in DNA damage checkpoint; involved in G2/M
phase transition; 14-3-3 protein; negatively regulates Byr2p
by affecting its localization; overexpression results in cell
cycle defects; similar to Sp rad25 |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
1220 |
ORF length (spliced) |
813 |
Entry clone length |
1220 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC8E11.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACTACTTCTCGTGA |
Rev primer name |
SPAC8E11.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCGTCCGCCTTGGGCTCA |
Amino acid length |
270 |
Molecular weight |
30 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; periphery at
site of septum formation; SPB |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |