Gene name |
SPBC16A3.09c |
Gene ID |
40/D12 |
Gene synonyms/obsolete |
ufd1 |
Gene product |
ubiquitin fusion
degradation protein (putative); Cdc48-Ufd1-Npl4 complex
component (putative); involved in proteasomal processing;
involved in the recognition of polyubiquitin-tagged
proteins |
Entry clone |
Cloned |
ORF length (unspliced) |
1360 |
ORF length (spliced) |
1029 |
Entry clone length |
1360 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
99T:C / 430T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC16A3.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCGGCAGCTTTTTCTC |
Rev primer name |
SPBC16A3.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCATCAATATCGATTGGG |
Amino acid length |
342 |
Molecular weight |
38.2 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPYWMMTTLSL |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |