| Gene name |
SPBC4B4.08 |
| Gene ID |
40/F03 |
| Gene synonyms/obsolete |
ght2 |
| Gene product |
hexose transporter;
similar to Sp GHT1 and GHT3 and GHT4 and GHT5 and GHT6 and
SPCC548.06C and SPBC1348.14C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1596 |
| ORF length (spliced) |
|
| Entry clone length |
1596 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
129T:C / 508A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4B4.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGTTCAAGCGTGGAAA |
| Rev primer name |
SPBC4B4.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCGTAATCTTCCTCATGG |
| Amino acid length |
531 |
| Molecular weight |
58.8 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi; periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |