Gene name |
SPBC776.12c |
Gene ID |
40/F05 |
Gene synonyms/obsolete |
hsk1 |
Gene product |
serine/threonine
protein kinase; Hsk1-Him1p/Dfp1p complex; involved in DNA
replication (initiation) (required); activated by Dfp1p;
required for genome integrity; involved in DNA replication
(required); minichromosome maintenance protein kinase |
Entry clone |
Cloned |
ORF length (unspliced) |
1645 |
ORF length (spliced) |
1524 |
Entry clone length |
1645 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
515T:G / 979A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC776.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGAGGCCCATATCAC |
Rev primer name |
SPBC776.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCTCCATCCTGCAAAGCA |
Amino acid length |
507 |
Molecular weight |
58.4 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDFLEKCLEL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |