| Gene name |
SPCC4F11.01 |
| Gene ID |
40/H03 |
| Gene synonyms/obsolete |
SPCC290.04 |
| Gene product |
cell cycle regulated;
zinc finger protein; zf-GATA type; involved in the centromeric
localization of CENP-A; overexpression suppresses cnp1-1;
involved in centromere function (required) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2191 |
| ORF length (spliced) |
2094 |
| Entry clone length |
2191 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC4F11.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGGAAAAGTCTCTGAA |
| Rev primer name |
SPCC4F11.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAAGTGTTTTCAACGGAT |
| Amino acid length |
697 |
| Molecular weight |
78.1 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNTVTSLPL |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |