Gene name |
SPAC2G11.11c |
Gene ID |
40/H06 |
Gene synonyms/obsolete |
prh1 |
Gene product |
ATP-dependent RNA
helicase; DEAD/DEAH box helicase |
Entry clone |
Cloned |
ORF length (unspliced) |
2286 |
ORF length (spliced) |
2160 |
Entry clone length |
2286 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
20A:G / 879T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2G11.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAAAGTCAGTGGAAA |
Rev primer name |
SPAC2G11.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGTGGACCGGCGGGCAAGG |
Amino acid length |
719 |
Molecular weight |
80.6 |
Isoelectric point (calc.) |
8.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |