| Gene name |
SPBP8B7.16c |
| Gene ID |
40/H08 |
| Gene synonyms/obsolete |
dbp2 |
| Gene product |
DEAD/DEAH box
helicase; involved in RNA processing; p68 family helicase;
overexpression results in cell cycle defects; large 3' intron
like Sc DBP2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2448 |
| ORF length (spliced) |
1653 |
| Entry clone length |
2448 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1664T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP8B7.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTACAGAGATAACGA |
| Rev primer name |
SPBP8B7.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCAACGTGAACGCGCAAGG |
| Amino acid length |
550 |
| Molecular weight |
61.5 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
351 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRVTYLVL |
| Localization (YFP) |
nucleolus>nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |