| Gene name |
SPBC21B10.01c |
| Gene ID |
41/A05 |
| Gene synonyms/obsolete |
cdc28; prp8;
SPBC19C2.01; SPBC874.01 |
| Gene product |
RNA helicase;
ATP-dependent; involved in mRNA splicing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3168 |
| ORF length (spliced) |
|
| Entry clone length |
3168 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2278C:T /
2421G:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21B10.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTAGAGCAATATGT |
| Rev primer name |
SPBC21B10.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCGCTTATGTCGTTTTTGC |
| Amino acid length |
1055 |
| Molecular weight |
121.2 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
114 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |