Gene name |
SPBC216.05 |
Gene ID |
41/B03 |
Gene synonyms/obsolete |
rad3 |
Gene product |
ATR (ATM) checkpoint
kinase; involved in DNA repair; involved in DNA damage
checkpoint; involved in DNA replication checkpoint; involved
in meiotic recombination |
Entry clone |
Cloned |
ORF length (unspliced) |
7161 |
ORF length (spliced) |
|
Entry clone length |
7161 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
3526T:C / 4071C:T /
5235A:C / 5655T:C / 7082A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC216.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCAACACGCAAAAAG |
Rev primer name |
SPBC216.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAAATAAGCAGCCCAACCA |
Amino acid length |
2386 |
Molecular weight |
273.5 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNFIYHGLPI/LNLFLLHYLSL/LEESVMLLLSL/LAYALQEFLKL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |