| Gene name |
SPAC4A8.15c |
| Gene ID |
41/C06 |
| Gene synonyms/obsolete |
cdc3 |
| Gene product |
profilin; involved in
cytokinesis; involved in contractile ring assembly; involved
in actin filament polymerization; essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
489 |
| ORF length (spliced) |
384 |
| Entry clone length |
489 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
36A:G / 309G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4A8.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTGGCAAGGTTTGTA |
| Rev primer name |
SPAC4A8.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATACCCAACACCAACAAGA |
| Amino acid length |
127 |
| Molecular weight |
13.4 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |