| Gene name |
SPBPB2B2.05 |
| Gene ID |
41/F06 |
| Gene synonyms/obsolete |
|
| Gene product |
GMP synthase
[glutamine-hydrolyzing]; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
793 |
| ORF length (spliced) |
714 |
| Entry clone length |
793 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
87A:G / 343A:T /
354T:C / 566T:C / 749A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBPB2B2.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGATAATTTTATAGCG |
| Rev primer name |
SPBPB2B2.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGGAGCAATTGGAATAGAG |
| Amino acid length |
237 |
| Molecular weight |
26.2 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKKIPILGI |
| Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |