Gene name |
SPBPB2B2.05 |
Gene ID |
41/F06 |
Gene synonyms/obsolete |
|
Gene product |
GMP synthase
[glutamine-hydrolyzing]; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
793 |
ORF length (spliced) |
714 |
Entry clone length |
793 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
87A:G / 343A:T /
354T:C / 566T:C / 749A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBPB2B2.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGATAATTTTATAGCG |
Rev primer name |
SPBPB2B2.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGGAGCAATTGGAATAGAG |
Amino acid length |
237 |
Molecular weight |
26.2 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKKIPILGI |
Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |