Gene name |
SPAC589.11 |
Gene ID |
41/F09 |
Gene synonyms/obsolete |
|
Gene product |
peptide chain release
factor; tRNA hydrolase; involved in translation termination;
similar to human ds-1 protein which shows modulated expression
during colon carcinoma cell differentiation |
Entry clone |
Cloned |
ORF length (unspliced) |
842 |
ORF length (spliced) |
549 |
Entry clone length |
842 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
748T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC589.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGCTAATTTCCGGAA |
Rev primer name |
SPAC589.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCATAGTGATACGACGT |
Amino acid length |
182 |
Molecular weight |
21.4 |
Isoelectric point (calc.) |
10.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
161 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |