| Gene name |
SPAC12B10.07 |
| Gene ID |
41/G03 |
| Gene synonyms/obsolete |
|
| Gene product |
F-actin capping
protein (alpha subunit); involved in actin filament
organization; involved in F-actin capping; actin cortical
patch component |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
881 |
| ORF length (spliced) |
771 |
| Entry clone length |
881 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC12B10.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAAGGAGGCAATTTA |
| Rev primer name |
SPAC12B10.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTATTTCTCATACGGATG |
| Amino acid length |
256 |
| Molecular weight |
29.8 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
probably actin
cytoskeleton |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |