| Gene name |
SPAC589.01c |
| Gene ID |
41/G07 |
| Gene synonyms/obsolete |
SPAC16A10.08c |
| Gene product |
sequence orphan;
hypothetical protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
913 |
| ORF length (spliced) |
858 |
| Entry clone length |
913 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
468G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC589.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAAACATAAGTCCTC |
| Rev primer name |
SPAC589.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTAAACTCGTCATTCATT |
| Amino acid length |
285 |
| Molecular weight |
32.7 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCKQLKELDL |
| Localization (YFP) |
cytoplasmic dots,
especially at cell tip and site of septum formation;
contractile ring |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |