Gene name |
SPAC13G6.04 |
Gene ID |
42/A06 |
Gene synonyms/obsolete |
tim8 |
Gene product |
mitochondrial carrier;
involved in import of zinc finger protein |
Entry clone |
Cloned |
ORF length (unspliced) |
354 |
ORF length (spliced) |
297 |
Entry clone length |
354 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC13G6.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGATGCAACAAAAAA |
Rev primer name |
SPAC13G6.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACACGAGAACCCAAGCCAA |
Amino acid length |
98 |
Molecular weight |
11.3 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
too dark to
photo |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |