| Gene name |
SPBC28F2.04c |
| Gene ID |
42/D04 |
| Gene synonyms/obsolete |
cwf7; spf27 |
| Gene product |
involved in mRNA
splicing (required); essential; 40S snRNP-containing complex;
nineteen complex (Ntc); complexed with Cdc5p; interacts
physically with Cwf8p (residues 57-141); functional homolog of
SNT309 (overexpression rescues) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
603 |
| ORF length (spliced) |
564 |
| Entry clone length |
603 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC28F2.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTATAATATATCTTT |
| Rev primer name |
SPBC28F2.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGACAAGAGAGTAGCAACA |
| Amino acid length |
187 |
| Molecular weight |
21.3 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEALEVQLEL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |