Gene name |
SPCC1259.03 |
Gene ID |
42/D06 |
Gene synonyms/obsolete |
rpa12 |
Gene product |
DNA-directed RNA
polymerase I subunitDNA-directed RNA polymerase activity
(A12.2 subunit); DNA-directed RNA polymerase I complex;
involved in transcription from Pol I promoter; functionally
complements Sc RPA12; non-essential: required for growth at
high temperatures |
Entry clone |
Cloned# |
ORF length (unspliced) |
605 |
ORF length (spliced) |
360 |
Entry clone length |
605 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
321T:addition |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1259.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGCAATAGGGTCTTT |
Rev primer name |
SPCC1259.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTGTTTGTACTAAATTTA |
Amino acid length |
119 |
Molecular weight |
13.1 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |