Gene name |
SPAC1805.07c |
Gene ID |
42/D12 |
Gene synonyms/obsolete |
hos2 |
Gene product |
DASH complex;
microtubule-binding comple; involved in chromosome
segregation; high osmolarity sensitivity for growth; non
essential |
Entry clone |
Cloned |
ORF length (unspliced) |
613 |
ORF length (spliced) |
285 |
Entry clone length |
613 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1805.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTCAAGCAAGGATTGA |
Rev primer name |
SPAC1805.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACCTCTTCAACATCGCCT |
Amino acid length |
94 |
Molecular weight |
10.3 |
Isoelectric point (calc.) |
4.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB;
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |