| Gene name |
SPAC23A1.11 |
| Gene ID |
42/F09 |
| Gene synonyms/obsolete |
rpl1602; rpl13a-2;
rpl16-2 |
| Gene product |
60S ribosomal protein
L16-a. 60S ribosomal protein L13/L16; similar to Sp rpl1601
and rpl1603 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
649 |
| ORF length (spliced) |
594 |
| Entry clone length |
649 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23A1.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAATTCCAGAAGGT |
| Rev primer name |
SPAC23A1.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAACCGAATTCAGCAAGC |
| Amino acid length |
197 |
| Molecular weight |
22 |
| Isoelectric point (calc.) |
11.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; occasionally
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |