Gene name |
SPAC10F6.12c |
Gene ID |
43/A01 |
Gene synonyms/obsolete |
mam4 |
Gene product |
protein-s
isoprenylcysteine o-methyltransferase; farnesyl cysteine
carboxyl methyltransferase that modifies M-factor; cells
defective in mam4 do not secrete active mating pheromone
M-factor |
Entry clone |
Cloned# |
ORF length (unspliced) |
711 |
ORF length (spliced) |
|
Entry clone length |
711 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC10F6.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAATTTACATACGTC |
Rev primer name |
SPAC10F6.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGGAATTAAGGGAATTCCA |
Amino acid length |
236 |
Molecular weight |
26.5 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
strong signal of
peripheral ER |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |