Gene name |
SPBC428.13c |
Gene ID |
43/A08 |
Gene synonyms/obsolete |
mob1 |
Gene product |
SIN component;
involved in cytokinesis (required); involved in septation;
interacts physically with Sid2p; essential; protein kinase
regulator Mob1; maintenance of ploidy protein Mob1;
Sid2p-Mob1p kinase complex; Mob1/phocein family |
Entry clone |
Cloned |
ORF length (unspliced) |
738 |
ORF length (spliced) |
633 |
Entry clone length |
738 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC428.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGGATTTAGTAATAA |
Rev primer name |
SPBC428.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACCATGCTATCTACCAAG |
Amino acid length |
210 |
Molecular weight |
24.7 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; periphery at site
of septum formation; nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |