Gene name |
SPAC521.03 |
Gene ID |
43/B12 |
Gene synonyms/obsolete |
|
Gene product |
short chain
dehydrogenase |
Entry clone |
Cloned |
ORF length (unspliced) |
780 |
ORF length (spliced) |
|
Entry clone length |
780 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
119G:A / 136G:A |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC521.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCGTTTGGATGGAAA |
Rev primer name |
SPAC521.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGCTTGCTTTCTGTACACA |
Amino acid length |
259 |
Molecular weight |
28.1 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |